View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_34 (Length: 324)
Name: NF11137_low_34
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 21 - 309
Target Start/End: Original strand, 50229727 - 50230015
Alignment:
| Q |
21 |
ggggtattacttgtaatcttaaataatcttttgagtatttttatagataatcacgaagctttctacgaggatgccgagcttagaaagcagaatgaaggta |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229727 |
ggggtattacttgtaatcctaaataatcttttgagtatttttatagataatcacgaagctttctacgaggatgccgagcttagaaagcagaatgaaggta |
50229826 |
T |
|
| Q |
121 |
ctcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtttcttcaactatagatgaggtacaaaattaatgcgatctcattgtctatc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50229827 |
ctcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtttcttcaactatagatgaggtacaaaattaatgcgatcttattgtctatc |
50229926 |
T |
|
| Q |
221 |
acacttaactgcatgtttagattgacggtaagttttgcagaataagctgtgccacgatgatcatggcgaaaaaactagactttgtagct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50229927 |
acacttaactgcatgtttagattgacggtaagttttgcagaataagctttgctacgatgatcatggcgaaaaaactacactttgtagct |
50230015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University