View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_38 (Length: 272)
Name: NF11137_low_38
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 10460405 - 10460669
Alignment:
| Q |
1 |
cttgccactgagatataattgtgtaggaatatcacatttgtggatattggagactgtttctggctttgactttgttaatgatccagtcaatgctagcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10460405 |
cttgccactgagatataattgtgtaggaatatcacatttgtggatattggagactgtttctggctttgactttgttaatgatccagtcaatgctagcaaa |
10460504 |
T |
|
| Q |
101 |
ggttccaacaatagagtttggctttcactttctctttcgttttccttccttatttcttctactaaggctttgcctgtgtcaatacctgttaagatcaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10460505 |
ggttccaacaatagagtttggctttcactttctctttcattttccttccttatttcttctactaaggctttgcctgtgtcaatacctgttaagatcaagg |
10460604 |
T |
|
| Q |
201 |
agggaaataaattcatatccatatgtgaggtcttggggattattgataagttaccatctctgctt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10460605 |
agggaaataaattcatatccatatgtgaggtcttggggattattgataagttaccatctatgctt |
10460669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University