View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_43 (Length: 250)
Name: NF11137_low_43
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 45776774 - 45776533
Alignment:
| Q |
1 |
cttcaaatcttgagttgatctcattcgaagctggttgtaggaatcttctaaaacatacgcccttcttactgatattcttagtgggctgtggtgatggtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45776774 |
cttcaaatcttgagttgatctcattcgaagctggttgtaggaatcttctaaaacatacgcccttcttactgatattcttagtgggctgtggtgatggtca |
45776675 |
T |
|
| Q |
101 |
tgctgatgcttgatttttgatcggaagtaggaacgcttgttatcaaaatcaatgaatcttggaatcttcaacataagggcaaaagacttctcaagcaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45776674 |
tgctgatgcttgatttttgatcggaagtaggaacgcttgttatcaaaatcaatgaatcttggaatcttcaacataagggcaaaagacttctcaagcaagc |
45776575 |
T |
|
| Q |
201 |
caggattttgcctgataaaagcatttagcagcttcctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45776574 |
caggattttgcctgataaaagcatttagcagcttcctatgct |
45776533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 28159318 - 28159554
Alignment:
| Q |
1 |
cttcaaatcttgagttgatctcattcgaagctggttgtaggaatcttctaaaacatacgcccttcttactgatattcttagtgggctgtggtgatggtca |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||||| || |||||||||| |||||| |||||||| || |||||||||| ||||| |||||||||||| |
|
|
| T |
28159318 |
cttcaaatcttgagttggtctcatgcgaagttggttataagaatcttctagaacatatgcccttctgacagatattcttaacgggctatggtgatggtca |
28159417 |
T |
|
| Q |
101 |
tgctgatgcttgatttttgatcggaagtaggaacgcttgttatcaaaatcaatgaatcttggaatcttcaacataagggcaaaagacttctcaagcaagc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||||||||||||||| || |||||||||| ||||| ||| || || || ||||||||||| | |
|
|
| T |
28159418 |
tgctgatgcttaatttttgatcggaagtgagcgcgcttgttatcaaaatcgataaatcttggaaccttcagcatgagtaagaaggatttctcaagcaaac |
28159517 |
T |
|
| Q |
201 |
caggattttgcctgataaaagcatttagcagcttcct |
237 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
28159518 |
caggattttgccttataaaagcatttagaagcttcct |
28159554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University