View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_44 (Length: 248)
Name: NF11137_low_44
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_44 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 22773633 - 22773865
Alignment:
| Q |
1 |
acggagaagaaccgctgacgatgattcactcgacacacttccagtttatcaccgcaccgccgcaagaagagacgtttcccggtcacgatcaccgacggtg |
100 |
Q |
| |
|
||||||||||| ||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||| ||||| |
|
|
| T |
22773633 |
acggagaagaaacgccgaggatgattccctcgacacacttccagtttatcaccgcaccgccgcaagaagagatgtttctcggtcacgatctccgccggtg |
22773732 |
T |
 |
| Q |
101 |
aataagatgattcacgctattcccttgcttgtgttcatttgtctcttcactctctggtggttctcttttccaggtattgttttttcacgcgcttcgttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||| |
|
|
| T |
22773733 |
aataagatgattcacgctattcccttgcttgtgttcatttgtctcttcactctctggtggttctcttttccaggtatcgtttcttcacgcgcttcgctaa |
22773832 |
T |
 |
| Q |
201 |
tttcattttcacgcgctcctttcttttaatctt |
233 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |
|
|
| T |
22773833 |
tttcattttcacccgctcttttcttttaatctt |
22773865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 177
Target Start/End: Original strand, 454725 - 454834
Alignment:
| Q |
68 |
agagacgtttcccggtcacgatcaccgacggtgaataagatgattcacgctattcccttgcttgtgttcatttgtctcttcactctctggtggttctctt |
167 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||| | ||||| | ||||||| | | |||| ||||||||||||||||||||||| |
|
|
| T |
454725 |
agagatgtttcccggtcacgatcaccggcagtgaataagatgcattttactattacattgcttgctgtgttatgtcccttcactctctggtggttctctt |
454824 |
T |
 |
| Q |
168 |
ttccaggtat |
177 |
Q |
| |
|
|||||||||| |
|
|
| T |
454825 |
ttccaggtat |
454834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University