View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_48 (Length: 239)
Name: NF11137_low_48
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 37084049 - 37083879
Alignment:
| Q |
20 |
aagtgcaagagattggaagaaaaaataaaccctcaaagccctttttctctctcaatgtcttatgttttttctacttgctccattgatgatgcaaaacctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
37084049 |
aagtgcaagagattggaagaaaaaataaaccctcaaagccctttttctctctcaatgtcttatatttcttctccttgctccactgatgatgcaaaacctt |
37083950 |
T |
 |
| Q |
120 |
ccactcttctccaaactctcaaactagtgtttttctccgtgtttttccattcgttatcctcacttcactct |
190 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
37083949 |
ccactctcctccaaactcccaaactagtgtttttctccatgtttttcctttcgttatcctcacttcactct |
37083879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University