View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_56 (Length: 216)
Name: NF11137_low_56
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 25 - 206
Target Start/End: Complemental strand, 45257439 - 45257258
Alignment:
| Q |
25 |
gccacaccatgatcaaatccgtcgattctgatggtgacggtaacgttaactttgaagagtttaagaagatgatgaacaataatcaggccaatagcaatta |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45257439 |
gccacaccatgatcaaatccgtcgattctgatggtgacggtaacgttaactttgaagagtttaagaagatgatgaacaataatcaggccaatagcaatta |
45257340 |
T |
 |
| Q |
125 |
ggcattttccatttctgaatttagtactaacagatctgctcctgtcatatgcctaatagcattttcgattctctctgcttct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45257339 |
ggcattttccatttctgaatttagtactaacagatctgctcctgtcatatgcctaatagcattttcgattctctctggttct |
45257258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University