View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_7 (Length: 528)
Name: NF11137_low_7
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 333 - 481
Target Start/End: Original strand, 30587893 - 30588042
Alignment:
| Q |
333 |
ttgggcaaccattttcatttgtgaaatctaggccaataaaagaccataattgcnnnnnnnnnnnnnnnnnnnnnnncacttgttcttctt-catcttctt |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
30587893 |
ttgggcaaccattttcatttgtgaaatctaggccaataaaagaccataattgcaaaataaaataaaataaaagaaacacttgttcttctttcttcttctt |
30587992 |
T |
 |
| Q |
432 |
tgttttcaccaagctctgttctacagagagatccaactccatctctctct |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30587993 |
tgttttcaccaagctctgttctacagagagatccaattccatctctctct |
30588042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 106 - 175
Target Start/End: Original strand, 30587802 - 30587871
Alignment:
| Q |
106 |
gaaaggtgatggatgtaagactagggttgtactgattttaagaaaaattgtgactataattaattactat |
175 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| | ||| |||||||| |||||| |
|
|
| T |
30587802 |
gaaaggtgatggatgtaggactaaggttgtactgattttaagaaaaatcgcgacgataattaactactat |
30587871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University