View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11138_low_5 (Length: 417)
Name: NF11138_low_5
Description: NF11138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11138_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 196 - 404
Target Start/End: Complemental strand, 34640171 - 34639962
Alignment:
| Q |
196 |
aactatttgagttcaaa--attgagtttctagtgagctaaattgttcttctttcttttacttgtattgttccatccttagtcatcttgtctctcgacgtg |
293 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34640171 |
aactatttgagttcaaattattgagtttctagtgagctaaattgttcttctttcttttacttgcattgttccatccttagtcatcttgtctctcgacgtg |
34640072 |
T |
 |
| Q |
294 |
gttattatataacatcatttgcctttaaaacaaacaaaaacttacttgaattcactaacctagatatttgcactcatataaacacttcatgagttcttta |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34640071 |
gttattatataacatcatttgcctttaaaacaaacaaaaacttacttgaattcactaa-ctagatatttgcactcatataaacacttcatgagttcttta |
34639973 |
T |
 |
| Q |
394 |
ataaattgtct |
404 |
Q |
| |
|
||||||||||| |
|
|
| T |
34639972 |
ataaattgtct |
34639962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 34640354 - 34640236
Alignment:
| Q |
13 |
aaaaattgtattgttccaaaatgatattaattgcttctttattttacttgtattatacttgtatcacataccaaaattggatcattttagatacctctgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34640354 |
aaaaattgtattgttccaaaatgatattaattgcttctttattttacttgtattatacttgtattacataccaaaattggatcattttagatgcctctgg |
34640255 |
T |
 |
| Q |
113 |
aagtaagtaaagtctcaga |
131 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34640254 |
aagtaagtaaagtctcaga |
34640236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University