View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11138_low_6 (Length: 382)
Name: NF11138_low_6
Description: NF11138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11138_low_6 |
 | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0060 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 368
Target Start/End: Complemental strand, 39410 - 39061
Alignment:
| Q |
20 |
aaaacaagcttacaagtaaattcccatgaattggagtgaaaatggaagttttgaaaaatgaagggagaggggcggatcaccaagaatggagggaaaagtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
39410 |
aaaacaagcttacaagtaaattcccatgaattggagtgataatggaagttttggaaaatgaagggagaggggcagttcaccaagaatggagggaaaagtg |
39311 |
T |
|
| Q |
120 |
gttttgaagcttggctcttgcttaaaactctacatggaactcctttgtagcatgatttgatgattccatggaaaaatttgatgaattttgatggattggg |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| | |
|
|
| T |
39310 |
gttttgaaggttggctcttgcttaaaactttacatggaactcctttgtagcatgatttgatgattccatgaaaatttttgatgaattttgatggattaga |
39211 |
T |
|
| Q |
220 |
gtgaagtagagagggaggacgtgtgctagagagggggaggaaggaaaaatccaga--ttttttccaatgagagaatagtgtagaaacttgtagaaaattt |
317 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |||||| ||||||||||||||||||| |||||||||||||| | |
|
|
| T |
39210 |
gtgaagtagagagagaggacgtgtgctagaga--gggaggaaggaaaaattcagatttttttttcaatgagagaatagtgtaggaacttgtagaaaatct |
39113 |
T |
|
| Q |
318 |
atat-aatttgtcttatatacaccctttgtcggaaaacaccattttaccctc |
368 |
Q |
| |
|
|||| | ||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
39112 |
atatgattttgtcttatatacaccctttgtgggaaaagaccattttaccctc |
39061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 340
Target Start/End: Original strand, 15089626 - 15089669
Alignment:
| Q |
297 |
gtagaaacttgtagaaaatttatataatttgtcttatatacacc |
340 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
15089626 |
gtagaaacttgtagaaaaatcatacaatttgtcttatatacacc |
15089669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 340
Target Start/End: Original strand, 22212236 - 22212279
Alignment:
| Q |
297 |
gtagaaacttgtagaaaatttatataatttgtcttatatacacc |
340 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
22212236 |
gtagaaacttgtagaaaaatcatacaatttgtcttatatacacc |
22212279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University