View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11139_high_5 (Length: 307)
Name: NF11139_high_5
Description: NF11139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11139_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 3332316 - 3332589
Alignment:
| Q |
20 |
gtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332316 |
gtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagct |
3332415 |
T |
 |
| Q |
120 |
ggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332416 |
ggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgt |
3332515 |
T |
 |
| Q |
220 |
tgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332516 |
tgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtg |
3332589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 60 - 140
Target Start/End: Original strand, 13212814 - 13212894
Alignment:
| Q |
60 |
gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt |
140 |
Q |
| |
|
||||| |||||||| | |||||||| || |||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
13212814 |
gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt |
13212894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 90 - 138
Target Start/End: Original strand, 32803230 - 32803278
Alignment:
| Q |
90 |
ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc |
138 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32803230 |
ggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc |
32803278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
| Q |
90 |
ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc |
138 |
Q |
| |
|
|||||||||||||||||||| || || | |||||||||||||||||||| |
|
|
| T |
16578665 |
ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc |
16578617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 103 - 138
Target Start/End: Original strand, 32809703 - 32809738
Alignment:
| Q |
103 |
tgtttttggatccagctggtcttcctcttggtcttc |
138 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32809703 |
tgtttttggatccaggtggtcttcctcttggtcttc |
32809738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 46200964 - 46200911
Alignment:
| Q |
77 |
tgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctct |
130 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||| ||| | |||||| |
|
|
| T |
46200964 |
tgtgatgataataggtggttttggtttgttttttgagccaggtggacgtcctct |
46200911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University