View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11139_low_12 (Length: 215)
Name: NF11139_low_12
Description: NF11139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11139_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 8755809 - 8755663
Alignment:
| Q |
12 |
agcaaaggcaaaatagattccacagcccccaaaatccagttggcatcgatcctataaatattgagtttcgagttccaatcaaatttttcataacatat-g |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8755809 |
agcaaaggcaaaatagattccacagcccccaaaatccagttggcatctatcctataaatattgagtttcgagttccaatcaaatttttcataacatatat |
8755710 |
T |
 |
| Q |
111 |
ggatcagcgagtgaaaagactaaatagtactccctccgtttcaaaat |
157 |
Q |
| |
|
|||| ||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
8755709 |
ggatgagcaagtgaaaatactaaatagtactccctccgttttaaaat |
8755663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University