View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1113_high_6 (Length: 202)
Name: NF1113_high_6
Description: NF1113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1113_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 8e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 35542894 - 35542730
Alignment:
| Q |
17 |
atactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgataactacttagagtagaaagaaagaaaaacactcttaggaaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35542894 |
atactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgataact---tagagtagaaagaaagaaaatcactcttaggaaatt |
35542798 |
T |
|
| Q |
117 |
agggtttgacatgagtaactaatcttagtgtagagtatcatttaggaacatcttggctgtagcaccac |
184 |
Q |
| |
|
| ||||||||||||||||||| ||| | || || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
35542797 |
aaggtttgacatgagtaactagtctcaatgaagggtatcatttaggagcatcttggctgtagcaccac |
35542730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 87 - 184
Target Start/End: Complemental strand, 35528332 - 35528235
Alignment:
| Q |
87 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaactaatcttagtgtagagtatcatttaggaacatcttggctgtagcaccac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35528332 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaactagtcttagtgtagggtatcgtttaggaacatcttggctgtagcaccac |
35528235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University