View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1113_low_11 (Length: 228)
Name: NF1113_low_11
Description: NF1113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1113_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 12 - 126
Target Start/End: Original strand, 8176129 - 8176243
Alignment:
| Q |
12 |
tcactaaatcagttactatatcacaatcttttttgtagttttgcaagcataatattaatgacatggaagtgctatagtatatgctacctggacaatcctg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176129 |
tcactaaatcagttactatatcacaatcttttttgtagttttgcaagcataatattaatgacatggaagtgctatagtatatgctacctggacaatcctg |
8176228 |
T |
 |
| Q |
112 |
taaagaccaggaata |
126 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8176229 |
taaagaccaggaata |
8176243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University