View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1113_low_13 (Length: 201)
Name: NF1113_low_13
Description: NF1113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1113_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 35542897 - 35542730
Alignment:
| Q |
13 |
ataatactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgataactacttagagtagaaagaaagaaaaacactcttaggaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
35542897 |
ataatactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgataact---tagagtagaaagaaagaaaatcactcttaggaa |
35542801 |
T |
|
| Q |
113 |
attagggtttgacatgagtaactaatcttagtgtagagtatcatttaggaacatcttggctgtagcaccac |
183 |
Q |
| |
|
|||| ||||||||||||||||||| ||| | || || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
35542800 |
attaaggtttgacatgagtaactagtctcaatgaagggtatcatttaggagcatcttggctgtagcaccac |
35542730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 86 - 183
Target Start/End: Complemental strand, 35528332 - 35528235
Alignment:
| Q |
86 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaactaatcttagtgtagagtatcatttaggaacatcttggctgtagcaccac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35528332 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaactagtcttagtgtagggtatcgtttaggaacatcttggctgtagcaccac |
35528235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University