View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1113_low_14 (Length: 201)
Name: NF1113_low_14
Description: NF1113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1113_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 25899438 - 25899353
Alignment:
| Q |
1 |
aacttgaaatgagaatgg-caaggtcctgatacattgatttgcttcaatccttttgtcgatccttaaggacatgatgatatctattg |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
25899438 |
aacttgaaatgagaatgggcaaggtcctgatacattgatttgcttcaatccttctgtcgat-cttaaggacatgatgatatctattg |
25899353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 5 - 88
Target Start/End: Original strand, 29200062 - 29200144
Alignment:
| Q |
5 |
tgaaatgagaatggcaaggtcctgatacattgatttgcttcaatccttttgtcgatccttaaggacatgatgatatctattggt |
88 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29200062 |
tgaaatgagaatgacaaggtcctgatacattgattttcttcaatgcttctgtcgat-cttaaggacatgatgttatctattggt |
29200144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University