View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1113_low_2 (Length: 605)
Name: NF1113_low_2
Description: NF1113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1113_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 3e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 170 - 335
Target Start/End: Complemental strand, 21707114 - 21706951
Alignment:
| Q |
170 |
gtcttttacacagtttcacattaacatatatatgtgcaagttacaagataataatagtagattacctgaacaacttgattcctcaaggaaccaatttaag |
269 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21707114 |
gtcttttacatagtttcacattaacatatatatgtgcaagttacaagataat--tagtacattacctgaacaacttgattcctcaaagaaccaatttaag |
21707017 |
T |
|
| Q |
270 |
aacggccatctcctaatgccgcctttatcaacagtatattcaaaattttagtaacatttatctttc |
335 |
Q |
| |
|
||| ||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21707016 |
aactgccatcttctaatgccacctttatcaacaatatattcaaaattttagtaacatttatctttc |
21706951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 74 - 151
Target Start/End: Complemental strand, 21707982 - 21707907
Alignment:
| Q |
74 |
atttacaatgcacgttccttcacttaaaagtagcttctataaattgttatttgacaattcacgcataagtttttctac |
151 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||| | ||||||| ||||||| |
|
|
| T |
21707982 |
atttacaatgcacgttccttcactt-aaagtagcttctattaattgttatttgac-attctcacataagtgtttctac |
21707907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University