View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11140_high_14 (Length: 209)
Name: NF11140_high_14
Description: NF11140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11140_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 9142422 - 9142598
Alignment:
| Q |
18 |
ttccataattgccaaatgatattgcgtttgttcaagttgaccggtcgtttgtgtaagttgctcagttgtttttgtaagcttctctgtagcctgtgtaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9142422 |
ttccataattgccaaatgatattgcgtttgttcaagttgaccggtcgtttgtgtaagttgctcagttgtttttgtaagcttctctggagcctgtgtaagc |
9142521 |
T |
 |
| Q |
118 |
tgttccttagtcttttcatatccaattagtttttctcccaaactttctacttgcttctgtaagtcttcaacattctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9142522 |
tgttccttagtcttttcatatccaattagtttttctcccaaactttctacttgcttctgtaagtcttcaacattctt |
9142598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 13552160 - 13552005
Alignment:
| Q |
18 |
ttccataattgccaaatgatattgcgtttgttcaagttgaccggtcgtttgtgtaagttgctcagttgtttttgtaagcttctctgtagcctgtgtaagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
13552160 |
ttccataattgccaaatgatattgcgtttgttcaagttgaccgttcgtttgtgtaagttgctcagttgtttttgtaagcttctatatagcctgtgtaagt |
13552061 |
T |
 |
| Q |
118 |
tgttccttagtcttttcatatccaattagtttttctcccaaactttctacttgctt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13552060 |
tgttccttagtcttttcatatccaattagtttttctcccaaactttctacttgctt |
13552005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University