View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11140_high_5 (Length: 263)
Name: NF11140_high_5
Description: NF11140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11140_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 4039236 - 4039004
Alignment:
| Q |
19 |
catcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatgtaatcgaattgtgcagtgtcattgatcaattcattgttgcttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039236 |
catcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatgtaatcgaattgtgcagtgtcattgatcaattcattgttgcttgt |
4039137 |
T |
|
| Q |
119 |
gctataatcctcatggtcattaaggaaatcagtgaactgatcaattgagaaatcttttgataattctccatatgcatccacttgttgttgcatctcctga |
218 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039136 |
gctataatcctcatgatcattgaggaaatcagtgaattgatcaattgagaaatcttttgatacttctccatatgcatccacttgttgttgcatctcctga |
4039037 |
T |
|
| Q |
219 |
cgatcctgatcattggctcgttgttgctcccta |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
4039036 |
cgatcgtgatcattggctcgttgttgctcccta |
4039004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University