View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11140_low_10 (Length: 247)
Name: NF11140_low_10
Description: NF11140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11140_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 43802343 - 43802099
Alignment:
| Q |
1 |
taatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactcttggatgcctcatgagctctgataaagcccactccacaactgtt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43802343 |
taatttgttcgccccaaccacgttatctagctcttgttggagatttttcatcactcttggatgcctcatgagctctgataaagcccactccacaaccgtt |
43802244 |
T |
 |
| Q |
101 |
gcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgttcgatcaacgacatgggttttttcgtcagagagatcgatcggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43802243 |
gcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgttcgatcaacgacatgggttttttcgtcagagggatcgatcggtt |
43802144 |
T |
 |
| Q |
201 |
ggtgcatcagtgagagtagaatgtctacgaaatccctatgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43802143 |
ggtgcatcagtgagagtagaatgtctacgaagtccttatgcttct |
43802099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 24 - 227
Target Start/End: Complemental strand, 43812889 - 43812686
Alignment:
| Q |
24 |
tatctagctcttgttggagatttttcatcactcttggatgcctcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggc |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| |||| |
|
|
| T |
43812889 |
tatccagctcttgttggagatttttcattactcttggatgcctcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggc |
43812790 |
T |
 |
| Q |
124 |
aatcatgtctagggatatagcctttatgtttgttcgatcaacgacatgggttttttcgtcagagagatcgatcggttggtgcatcagtgagagtagaatg |
223 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| ||||||| ||| |||||||||| |||| |||| |||||| ||||||||||||||||| |
|
|
| T |
43812789 |
gatcatgtctaaggctatagcctttatgtttgttcgatcaatgacatggctttgttcgtcagagggatcaatcgtctggtgcgtcagtgagagtagaatg |
43812690 |
T |
 |
| Q |
224 |
tcta |
227 |
Q |
| |
|
|||| |
|
|
| T |
43812689 |
tcta |
43812686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 29944776 - 29944727
Alignment:
| Q |
41 |
agatttttcatcactcttggatgcctcatgagctctgataaagcccactc |
90 |
Q |
| |
|
|||||||||||||||||||||||||| | || || |||||||||||||| |
|
|
| T |
29944776 |
agatttttcatcactcttggatgccttaaaagttcggataaagcccactc |
29944727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University