View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11140_low_3 (Length: 347)
Name: NF11140_low_3
Description: NF11140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11140_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 52035804 - 52035632
Alignment:
| Q |
1 |
aataagttctctcccgacaatgtatatcatagctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035804 |
aataagttctctcccgacaatgtatatcatcgctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacg |
52035705 |
T |
|
| Q |
101 |
atgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacacttttttaaaaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52035704 |
atgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacacttttgtaaaaa |
52035632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 203 - 254
Target Start/End: Complemental strand, 52035641 - 52035590
Alignment:
| Q |
203 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035641 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
52035590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 280 - 330
Target Start/End: Complemental strand, 52035589 - 52035539
Alignment:
| Q |
280 |
aatgaaccactttattctctctgaccaatttcaacataagactgcctcaat |
330 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52035589 |
aatgaaccactttattgtctctgaccaatttcaacataagactgcctcaat |
52035539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University