View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11140_low_9 (Length: 249)
Name: NF11140_low_9
Description: NF11140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11140_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 140
Target Start/End: Original strand, 36457800 - 36457924
Alignment:
| Q |
16 |
tcgaaaataggtagcagaccgaaaatgacattctgcggctggagtttatgctatttagaatgttatagaagttgaacattgtgtattggggttgagtacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36457800 |
tcgaaaataggtagcagaccgaaaatgacattctctggctggagtttatgctatttagaatgttataaaagttgaacattgtgtattggggttgagtacc |
36457899 |
T |
|
| Q |
116 |
tcatgtactcatttgcatcttattt |
140 |
Q |
| |
|
| |||||||||| |||||||||||| |
|
|
| T |
36457900 |
ttatgtactcatatgcatcttattt |
36457924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 36458064 - 36458164
Alignment:
| Q |
141 |
ttattttgaattagagcttgctataaattatttctatcacctaggaggagtatgccattggttggataataggctttcactttatgtggctctctatttc |
240 |
Q |
| |
|
|||||| || ||||||||| ||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458064 |
ttatttcgacttagagctt-ctacaaattacttgtatcacctaggaggagcatgccattggttggataataggctttcactttatgtggctctctatttc |
36458162 |
T |
|
| Q |
241 |
at |
242 |
Q |
| |
|
|| |
|
|
| T |
36458163 |
at |
36458164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University