View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11142_high_45 (Length: 291)

Name: NF11142_high_45
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11142_high_45
NF11142_high_45
[»] chr8 (1 HSPs)
chr8 (13-273)||(43602615-43602875)


Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 273
Target Start/End: Original strand, 43602615 - 43602875
Alignment:
13 atggacatcaaaagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgatatcgagcacacaaactctctatcagcagctacaa 112  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
43602615 atggatatcaaaagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgaaatcgagcacacaaactctctatcagcaactacaa 43602714  T
113 gatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatcctta 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43602715 gatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatcctta 43602814  T
213 tgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattac 273  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43602815 tgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattac 43602875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University