View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_37 (Length: 336)
Name: NF11142_low_37
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 16 - 325
Target Start/End: Original strand, 28233204 - 28233513
Alignment:
| Q |
16 |
gagaaaaccgctggatatcaaatctggaatcaagatcaataaatagaaccaaatgttcaaatccaccgtagtttatcccattccagtctttgggaagaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28233204 |
gagaaaaccgctggatatcaaatctggaatcaagatcaataaatagaaccaaatgttcaaatccaccgtagtttatccccttccagtctttgggaagaat |
28233303 |
T |
|
| Q |
116 |
gcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgaggacgttgccgacgcggagaggaactctgtgaagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28233304 |
gcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgaggacgttgccgacgcggagaggaactctgtgaagc |
28233403 |
T |
|
| Q |
216 |
ggcttagggaggatgaaaggtcggactctccatactcttttcagcatctcgctgccgctttcgtctccggcaatccagttttggagatgtggtctctcgt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28233404 |
ggcttagggaggatgaaaggtcggactctccatactcttttcagcatttcgctgccgctttcgtctccggcaatccagttttggaggtgtggtctctcgt |
28233503 |
T |
|
| Q |
316 |
gatgattcat |
325 |
Q |
| |
|
|||||||||| |
|
|
| T |
28233504 |
gatgattcat |
28233513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University