View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_38 (Length: 329)
Name: NF11142_low_38
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 30591220 - 30590939
Alignment:
| Q |
16 |
atattaattaaagatggcctgtgcaaatattacgtgcaagtaagtgggcagctttagggaatatgcatggtgagtaggggccggacattggaattttcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30591220 |
atattaattaaagatggcctgtgcaaatattacgtgcaagtaagtgggcagctttagggaatatgcatggtgagtaggggccggacattggaattttcca |
30591121 |
T |
|
| Q |
116 |
attgaagtaagttgcaaatgcaatgcaaaaatacagtgctaaatatgtggacacctctgcatattgttgttctattcagcggagtttctgggctacactt |
215 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30591120 |
attgaagtaagttacaaatgcaatgcgaaaatacagtgctaaatatgtggacacctctgcatattgttgttctattcagcggaatttctgggctacactt |
30591021 |
T |
|
| Q |
216 |
ttgatgtatcatttcacttatacagtagttgtctatcttagtgctgtacaaaatgatggagactagggctcactctttggtt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30591020 |
ttgatgtatcatttcacttatacagtagttgtctagcttagtgctgtacaaaatgatggagactagggctcactctttggtt |
30590939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University