View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_42 (Length: 315)
Name: NF11142_low_42
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 1608426 - 1608721
Alignment:
| Q |
1 |
aaactgtcaatgcaaagaacaggagaagtttaacatttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactccaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1608426 |
aaactgtcaatgcaaagaacaggagaagtttaacttttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactccaattt |
1608525 |
T |
|
| Q |
101 |
tgagtagtaaagaaaatacatttgtgacaaacatacatgtctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcgcaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1608526 |
tgagtagtaaagaaaatacatttgtgacaaacatacatgcctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcacaaac |
1608625 |
T |
|
| Q |
201 |
tatcataagcaaaatgagctaaaatgttgaacctttatgcattggaagccggtaaccatagcattgtcacttacaccatcactgctatgactaacc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608626 |
tatcataagcaaaatgagctaaaatgttgaacctttatgcattggaagccggtaaccatagcattgtcacttacaccatcactgctatgactaacc |
1608721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University