View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_46 (Length: 291)
Name: NF11142_low_46
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 273
Target Start/End: Original strand, 43602615 - 43602875
Alignment:
| Q |
13 |
atggacatcaaaagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgatatcgagcacacaaactctctatcagcagctacaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
43602615 |
atggatatcaaaagcgagtgcaattctagcaggaagaccaaagaattgggaagattttgctatgaaatcgagcacacaaactctctatcagcaactacaa |
43602714 |
T |
 |
| Q |
113 |
gatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatcctta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602715 |
gatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttgcagcaggatcctta |
43602814 |
T |
 |
| Q |
213 |
tgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602815 |
tgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattac |
43602875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University