View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_5 (Length: 580)
Name: NF11142_low_5
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 5e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 5e-70
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 25471102 - 25470909
Alignment:
| Q |
1 |
aacatatacaaagctgctgtcaagtgaaacaactttaattgctgatacaggtgattcaagacttaatttccaaaagctgaaatttccaagggggtgtgaa |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | | |||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25471102 |
aacatatacaaagctgttgtcaagtgaaacaactttaattgctaagataggtgattcacgacttaatttccaaaagctgaaatttccaagggtgtgtggg |
25471003 |
T |
 |
| Q |
101 |
taattttcatagagaatgtgatgtattatattatgagtttcaagtccaatatggtacaattggatcgtcctgctgttgcaactcgttgttgtgca |
195 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25471002 |
taattgtcatagagaatgtgctgtattatattctgagtttcaaat-caatatggcacaattggatcgtcctgctgttgcaactcgttgttgtgca |
25470909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 205 - 369
Target Start/End: Complemental strand, 25453796 - 25453632
Alignment:
| Q |
205 |
cctcaaaagccaagtgatgccttgcactagtgatgaaatcaagttcttgtgattgggaaaatcgaagcatcctaaatacatctcaaggcacttgtttaag |
304 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
25453796 |
cctcaaaatccaagtgatgccttgcactaggcatgaaatcaagttcttgtgattgggaaaatcgaagcatcctaaatgcatctcaaggcacttgtttagg |
25453697 |
T |
 |
| Q |
305 |
gcctttgcttggcggtcatattgaggatggtaagcgaaactcatggccgaagtggtgctttgtag |
369 |
Q |
| |
|
|||| |||||||| || ||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
25453696 |
gcctatgcttggcagtaatattgacgatgttaagcgaaactcatggcctaagtggtgctttgtag |
25453632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University