View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_52 (Length: 270)
Name: NF11142_low_52
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 41418450 - 41418189
Alignment:
| Q |
1 |
cgatggcaccatcgccgaaccctacaacccttccctcacccttcccatccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418450 |
cgatggcaccatcgccgaaccctacaacccttccctcacccttcccatccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataa |
41418351 |
T |
 |
| Q |
101 |
tccttttactgtgttcgacgaaattcctcactgacataaatggcttat--------tttgcaggtgaagttggtggctccgagtctcatgccgaagttgg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418350 |
tccttttactgtgttcgacgaaattcctcactgacataaatggcttattttgttgttttgcaggtgaagttggtggctccgagtctcatgccgaagttgg |
41418251 |
T |
 |
| Q |
193 |
gtaaagcaggaagcttgcaaagcagggtgaacattgtgcatagtcttgctcatattgagagt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418250 |
gtaaagcaggaagcttgcaaagcagggtgaacattgtgcatagtcttgctcatattgagagt |
41418189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University