View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_63 (Length: 245)
Name: NF11142_low_63
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 33073639 - 33073427
Alignment:
| Q |
15 |
gaccttaacaattttaaggtattaataaaccaggagagtttgattggtagaaaataaacgagagttaacaacacattctcaaacacgttcttgtaactat |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33073639 |
gaccttaacaattttaaggaattaataaacgaggagagttcgtttggtagaaaataaacgagagttaacaacacattctctaacacgttcttgtaactat |
33073540 |
T |
|
| Q |
115 |
tttgtatatcttgtaaagacttattgttagtggattgatgagttatactctttatctgcttaaatgtagatcaatttagatcgaattgagtaaataattt |
214 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
33073539 |
tttgtatatcttataaagacacactgttagtggattgatgagttatactctttatctgtctaaatgtaaatcaatttggatcgaattgagtaaacaattt |
33073440 |
T |
|
| Q |
215 |
tgatttctatctt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33073439 |
tgatttctatctt |
33073427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University