View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_65 (Length: 242)
Name: NF11142_low_65
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 76 - 240
Target Start/End: Complemental strand, 10416035 - 10415866
Alignment:
| Q |
76 |
atccaaaatcaaatgtatctcaaagttttcaactaaggactaatcacta-------gcgtggctgcgctggccaaacannnnnnngacaccgacgaaaat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||| | |
|
|
| T |
10416035 |
atccaaaatcaaatgtatctcaaagtttttaactaaggactaatcactatcgtggtgcgtggctgcgctggccaaacatttttttgacaccgacgaa--t |
10415938 |
T |
|
| Q |
169 |
ctatgtaacatgtatctttgataaatagtacaaacatctataaaacaaaacctaaattttatcccatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10415937 |
ctatgtaacatgtatctttgataaatagtacaaacatctataaaacaaaacctaaattttatcccatctctg |
10415866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 10416118 - 10416079
Alignment:
| Q |
1 |
taatagtataaacaaaacatttttaaatttaaattcaatt |
40 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10416118 |
taatagtataaacaaaaaaattttaaatttaaattcaatt |
10416079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 235
Target Start/End: Complemental strand, 10415850 - 10415816
Alignment:
| Q |
201 |
aacatctataaaacaaaacctaaattttatcccat |
235 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
10415850 |
aacatctatagaacaaaacctaaattttatcccat |
10415816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University