View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_73 (Length: 227)
Name: NF11142_low_73
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 35040244 - 35040165
Alignment:
| Q |
1 |
attgttaagaagtaaagaaacagaccaggtcaatgtcgctgcggtagtgtctagtacctgctagaattagtgcctgcaaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35040244 |
attgttaagaagtaaagaaacagaccaggtcaatgtcgctgcggtagtgtct-gtacctgctagaattagtgcctgcaaaa |
35040165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 141 - 214
Target Start/End: Complemental strand, 35040105 - 35040032
Alignment:
| Q |
141 |
gataattgaaagttgagtatttataatgtcgcaactnnnnnnntctattaggacattcagttgtttataccttc |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
35040105 |
gataactgaaagttgagtatttataatgtcgcaactaaaaaaatctattaggacgttcagttgtttataccttc |
35040032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 35026281 - 35026202
Alignment:
| Q |
1 |
attgttaagaagtaaagaaacagaccaggtcaatgtcgctgcggtagtgtctagtacctgctagaattagtgcctgcaaaa |
81 |
Q |
| |
|
|||||||||||||||||| | || ||| |||||||| |||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35026281 |
attgttaagaagtaaagatagagtccaagtcaatgttcctgctgtagtgtct-gtagctgctagaattagtgcctgcaaaa |
35026202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 35032227 - 35032148
Alignment:
| Q |
1 |
attgttaagaagtaaagaaacagaccaggtcaatgtcgctgcggtagtgtctagtacctgctagaattagtgcctgcaaaa |
81 |
Q |
| |
|
|||||||||||||||||| | ||||| |||||||| |||||||||| ||| ||| | |||||||||| ||||||||||| |
|
|
| T |
35032227 |
attgttaagaagtaaagatagtgaccatgtcaatgttcctgcggtagtatct-gtagccgctagaattaatgcctgcaaaa |
35032148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University