View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_74 (Length: 223)
Name: NF11142_low_74
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 3731785 - 3731593
Alignment:
| Q |
16 |
agagaaaacactaagagtaagataccctgcatgttcattagcagctaaaagacacatagcttccaccacaagtatcttggatgtcaatggagtagtaagc |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3731785 |
agagaaaacactaagagttagataccctgcatgttcgttagcagctaaaagacacatagcttccaccacaagtatcttggatgtcaatggagtagtaagc |
3731686 |
T |
 |
| Q |
116 |
aaatttttcagtgtttcataatttatcatatggtctattaatgctgatttggttatgtggttgtattattcttctagggaatgtctaatttct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3731685 |
aaatttttcagtgtttcataatttatcatatagtctaataatgctgatttggttatgtggttgtattattcttctagggaatgtctaatttct |
3731593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 11684103 - 11683907
Alignment:
| Q |
16 |
agagaaaacactaagagtaagataccctgcatgttcattagcagctaaaagacacatagcttccaccacaagtatcttggatgtcaatggagtagtaagc |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11684103 |
agagaaaaccctaagagtaagataccctgcatgttcattagcagccaaaagacacatagcatccaccacaagtatcttggatggcaatggagtagtaagc |
11684004 |
T |
 |
| Q |
116 |
aaatttttc----agtgtttcataatttatcatatggtctattaatgctgatttggttatgtggttgtattattcttctagggaatgtctaatttct |
208 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11684003 |
aaatttttcatatagtgtttcataatttactatatggtctaataatgctgattttgttatgtgattgtattattcttctagggaatgtctaatttct |
11683907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University