View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_75 (Length: 221)
Name: NF11142_low_75
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 99 - 206
Target Start/End: Original strand, 2632235 - 2632342
Alignment:
| Q |
99 |
caatctcaataatcttctagaaatgctagtttctagaattgcaatatgatttgactttcttgcttctattggttggtttgaacttgaatcatatcatatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2632235 |
caatctcaataatcttctagaaatgctagtttctagaattgcaagatgatttgactttcttgcatctattggttggtttgaacttgaatcatatcatatg |
2632334 |
T |
|
| Q |
199 |
ttagtttt |
206 |
Q |
| |
|
|||||||| |
|
|
| T |
2632335 |
ttagtttt |
2632342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 140
Target Start/End: Complemental strand, 751540 - 751499
Alignment:
| Q |
99 |
caatctcaataatcttctagaaatgctagtttctagaattgc |
140 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
751540 |
caatctcaataatcttctagcaatgctagtatctagatttgc |
751499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 2503781 - 2503841
Alignment:
| Q |
112 |
cttctagaaatgctagtttctagaattgcaatatgatttgactttcttgcttctattggtt |
172 |
Q |
| |
|
||||| ||||||||||||||||| ||||| | ||| ||||||| |||||| ||| |||||| |
|
|
| T |
2503781 |
cttcttgaaatgctagtttctagtattgctagatggtttgactctcttgcatctgttggtt |
2503841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 195
Target Start/End: Complemental strand, 2650386 - 2650305
Alignment:
| Q |
112 |
cttctagaaatgctagtttctagaattgcaatatgatttgactttcttgcttctattggttggtttgaacttgaatcatatcat |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||| |||||| | | |||||| ||| |||||| ||||||||| |
|
|
| T |
2650386 |
cttctagaaatgctagtttctagtattgca--atggtttgactctcttgcatatgttggttaatttaaacttgtttcatatcat |
2650305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University