View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11142_low_78 (Length: 202)
Name: NF11142_low_78
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11142_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 11 - 98
Target Start/End: Original strand, 35522727 - 35522814
Alignment:
| Q |
11 |
ggagcacagatggtcgcatttaacatgcaggtcagggacttaagatcaagtctcttttcaaataaaaggtttatcttagtatttacta |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35522727 |
ggagctcagatggtcgcatttaacatgcaggtcagggacttaagatcaagtctcttttcaaataaaaggtttatcttagtatttacta |
35522814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University