View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_high_16 (Length: 324)
Name: NF11144_high_16
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 287
Target Start/End: Original strand, 35604184 - 35604459
Alignment:
| Q |
11 |
cagagactacgggttttcaccttaaggtgcaagaacaatatgaatagcattaagagcgggaggtaagacaccggaggccagccaagaggaagcaaaggaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35604184 |
cagagactacgggttttcaccttaaggtgcaagaacaatatgagtagcattaagagcgggaggtaagacaccggaggccagccaagaggaagcaaaggaa |
35604283 |
T |
|
| Q |
111 |
taaacttccccttcaatctcatcccataaacggtggtagaaggttggattaaggttttccgaaccaatgatttgtatgagtgcatgctagcttccttgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35604284 |
taaacttccccttcaatctcatcccataaacggtggtagaaggttggattaaggttttccgaaccaatgatttgtatgagtgcatgctagcttccttgaa |
35604383 |
T |
|
| Q |
211 |
ttccacctctacaaaaggttaagcaagataatgagtatcttcatccgtcaccattgattgcatgcaaggttcaatct |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35604384 |
ttccatctctacaaaaggttaagcaagataat-agtatcttcatccgtcaccattgattgcatgcaaggttcaatct |
35604459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University