View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_high_17 (Length: 306)
Name: NF11144_high_17
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 145 - 289
Target Start/End: Complemental strand, 7222425 - 7222291
Alignment:
| Q |
145 |
atttgtaatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagtatgagaga--actcatggtaccatgacggtaaaaatcaagggtgtg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7222425 |
atttgtaatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagtatgagagaggactcatggtaccatgac------------gggtgtg |
7222338 |
T |
 |
| Q |
243 |
caatgcgattgtgtcattgcgatgagtcaaaatgtaagagacaaatt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7222337 |
caatgcgattgtgtcattgcgatgagtcaaaatgttagagacaaatt |
7222291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7222526 - 7222436
Alignment:
| Q |
1 |
tgtgaagtgacaggtctgtaattgctggaaaattaagagaattaggaaataatgcccctgtcccaagagaaagttcaagagatgttaaagt |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||| ||||||||||||||| |
|
|
| T |
7222526 |
tgtgaagttacaggtctgtaattgctggaaaattaagagaattaggaaataatgcccccgttccaggagaaagttgaagagatgttaaagt |
7222436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 150 - 201
Target Start/End: Original strand, 7058615 - 7058666
Alignment:
| Q |
150 |
taatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagtatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7058615 |
taatcgctggacattatgtgaaaaagcatatttcaaaattctttcgagtatg |
7058666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 199
Target Start/End: Complemental strand, 7126215 - 7126155
Alignment:
| Q |
139 |
acatctatttgtaatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagta |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| || ||||| |||||||||| |
|
|
| T |
7126215 |
acatcaatttgtaatcgctggacattatgtgaaaccgcataattaaaaatccttttgagta |
7126155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 147 - 199
Target Start/End: Complemental strand, 25216225 - 25216173
Alignment:
| Q |
147 |
ttgtaatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagta |
199 |
Q |
| |
|
||||||| | |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
25216225 |
ttgtaattgttggacattatgtgagaaagcatatttcaaaattcttttgagta |
25216173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 147 - 199
Target Start/End: Complemental strand, 25280377 - 25280325
Alignment:
| Q |
147 |
ttgtaatcgctggacattatgtgaaaaagcatgtttcaaaattcttttgagta |
199 |
Q |
| |
|
||||||| | |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
25280377 |
ttgtaattgttggacattatgtgagaaagcatatttcaaaattcttttgagta |
25280325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 25064525 - 25064481
Alignment:
| Q |
157 |
tggacattatgtgaaaaagcatgtttcaaaattcttttgagtatg |
201 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
25064525 |
tggacattatgtgcgaaagcatatttcaaaattattttgagtatg |
25064481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University