View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_high_19 (Length: 296)
Name: NF11144_high_19
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 20 - 282
Target Start/End: Complemental strand, 40839031 - 40838769
Alignment:
| Q |
20 |
cgagatcataaaattgcttgacatttatcataattacttctcccattatacatataataatatattgattgtgaatgtgatttattgacgaaaaatctta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839031 |
cgagatcataaaattgcttgacatttatcataactacttctcccattatacatataataatatactgattgtgaatgtgatttattgacgaaaaatctta |
40838932 |
T |
 |
| Q |
120 |
tttatgtattgaaatttaggtacatggagttctaaacattatagggtggggaacattgttacctatgggagtaataattccaagatactttcgagtgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40838931 |
tttatgtattgaaatttaggtacatggagttctaaacattatagggtggggaacgttgttacctatgggagtaataattccaagatactttcgagtgtat |
40838832 |
T |
 |
| Q |
220 |
ccttttaaaaaggatccatggtggttttacttgcacattggttgccaaacaactggttttctc |
282 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40838831 |
ccttttcacaaggatccatggtggttttacttgcacattggttgccaaacaactggttttctc |
40838769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University