View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_high_22 (Length: 263)
Name: NF11144_high_22
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 42038705 - 42038473
Alignment:
| Q |
14 |
agatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcatagtatggccaagatgcaatggagttgcagcagatgtaggtgtatgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038705 |
agatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcatagtatggccaagatgcaatggagttgcagcagatgtaggtgtatgg |
42038606 |
T |
|
| Q |
114 |
tacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgctaggcctggctccacaggatctgctctgtccacatcgtgaccaaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038605 |
tacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgcaaggcctggctccacaggatctgctctgtccacatcgtgaccaaat |
42038506 |
T |
|
| Q |
214 |
tctgaaggcaaaaacctctgcaacatattacat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42038505 |
tctgaaggcaaaaacctctgcaacatattacat |
42038473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University