View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_high_24 (Length: 250)
Name: NF11144_high_24
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 11202317 - 11202184
Alignment:
| Q |
1 |
aaaatcactatcactttcaatctcagcatcttgatcctcgtcggcggctactctacggcgtttggtgggaccgtcgtcgaaaaatgggtcgcgtgaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202317 |
aaaatcactatcactttcaatctcagcatcttgatcctcgtcggcggctactctgcggcgtttggtgggaccgtcgtcgaaaaatgggtcgcgtgaattc |
11202218 |
T |
|
| Q |
101 |
ttcttgcggttgttcattgcgggcatgattaggg |
134 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |
|
|
| T |
11202217 |
ttcttgcggttgttcttagcgggcatgattaggg |
11202184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 11202134 - 11202083
Alignment:
| Q |
184 |
gagacaaagacaaaggttgctgctagggtttaagtttcagaaatgagtgggtt |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202134 |
gagacaaa-acaaaggttgctgctagggtttaagtttcagaaatgagtgggtt |
11202083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University