View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11144_high_24 (Length: 250)

Name: NF11144_high_24
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11144_high_24
NF11144_high_24
[»] chr2 (2 HSPs)
chr2 (1-134)||(11202184-11202317)
chr2 (184-236)||(11202083-11202134)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 11202317 - 11202184
Alignment:
1 aaaatcactatcactttcaatctcagcatcttgatcctcgtcggcggctactctacggcgtttggtgggaccgtcgtcgaaaaatgggtcgcgtgaattc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
11202317 aaaatcactatcactttcaatctcagcatcttgatcctcgtcggcggctactctgcggcgtttggtgggaccgtcgtcgaaaaatgggtcgcgtgaattc 11202218  T
101 ttcttgcggttgttcattgcgggcatgattaggg 134  Q
    ||||||||||||||| | ||||||||||||||||    
11202217 ttcttgcggttgttcttagcgggcatgattaggg 11202184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 11202134 - 11202083
Alignment:
184 gagacaaagacaaaggttgctgctagggtttaagtttcagaaatgagtgggtt 236  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
11202134 gagacaaa-acaaaggttgctgctagggtttaagtttcagaaatgagtgggtt 11202083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University