View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_low_12 (Length: 363)
Name: NF11144_low_12
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 43979685 - 43979886
Alignment:
| Q |
1 |
gcgttatcactggcgcattcatcttcctcgctgaccttgttcgcaaaattgacctccctatcaccattgatcttatccgagctcaatcttacggttcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| || |
|
|
| T |
43979685 |
gcgttatcactggcgcattcatcttcctcgctgaccttgttcgcaaaattgacctccctatcaccattgatcttatcagagctcaatcctacggttctgg |
43979784 |
T |
 |
| Q |
101 |
tactgtctccaattgcgcacccaccgtttcttctgacttgaaggttgacatcaatggccgccacgtcatcttggtattgtttactctcttctaaccctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
43979785 |
tactgtctccaattgcgcacccaccgtttcttctgacttgaaggttgatgtcaatggccgccacgtcatcttggtattgttttctctcttctaatcctaa |
43979884 |
T |
 |
| Q |
201 |
ta |
202 |
Q |
| |
|
|| |
|
|
| T |
43979885 |
ta |
43979886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University