View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_low_19 (Length: 297)
Name: NF11144_low_19
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38683984 - 38684221
Alignment:
| Q |
1 |
cttctcaacacctttctctgctcaactacaaccccaacaacagcagcagcaacagcagaattcactctttcaactatcaccttctactggttttgggttt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38683984 |
cttctcaacaccgttctctgctcaacaacaaccccaacaacagcagcagcaacagcagaattcactctttcaactatcaccttctactggttttgggttt |
38684083 |
T |
|
| Q |
101 |
cagaattctacgccagcgccgcaaccttcgccgtttccaaattctcaattgactactcaaatggctaatgttgctccagttccattctcactggcggatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684084 |
cagaattctacgccagcgccgcaaccttcgccgtttccaaattctcaattgactactcaaatggctaatgttgctccagttccattctcactggcggatc |
38684183 |
T |
|
| Q |
201 |
gtgatattcaagtattattttttcactacactgttcaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684184 |
gtgatattcaagtattattttttcactacactgttcaa |
38684221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 158 - 237
Target Start/End: Complemental strand, 4160599 - 4160521
Alignment:
| Q |
158 |
caaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaagtattattttttcactacactgttca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
4160599 |
caaatggctaatgttgctccagttccattctcaccgaaggatcgtgatattcaagtattat-ttttcactatactgttca |
4160521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University