View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_low_22 (Length: 271)
Name: NF11144_low_22
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 32468022 - 32468280
Alignment:
| Q |
1 |
aattgtcacataaaatcaagatggttggtgctgtttaacttcatttgattgtttagtgaatgtgacttagagaaagaagaagatgatgagtcacaaaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32468022 |
aattgtcacataaaatcaagatggttggtgctgtttaacttcatttgattgtttggtgaatgtgacttagagaaagaagaagatgatgagtcacaaaggt |
32468121 |
T |
 |
| Q |
101 |
tatgaggtgaaaataatgagaatggagtatcattcaaggaagttgatggg-ttttttatgagcatagttgtgtagtgttgttttgagaaatgtgagttca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32468122 |
tatgaggtgaaaataatgagaatggagtatcattcaaggaagttgatgggtttttttatgagcatagttgtgtagtgttgttttgagaaatgtgagttca |
32468221 |
T |
 |
| Q |
200 |
cttcctatgaatttgtttatttgctatattatttccctttgtttttcagttctcttctt |
258 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32468222 |
cttcctatggatttgtttatttgctctattatttccctttgtttttcagttctcttctt |
32468280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University