View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11144_low_33 (Length: 208)
Name: NF11144_low_33
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11144_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 9023556 - 9023388
Alignment:
| Q |
19 |
ttacctggatgttactgaaaagagaataaatgtctcaatatagttttagccaacaaaatgactgaaaggtttgacnnnnnnnttgttgaagaaaggtaat |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9023556 |
ttacctggatgttagtgaaaagagaataaatgtctcaatatagttttagccaacaaaatgactgaaaggtttgacaaaaaaattgttgaagaaaggtaat |
9023457 |
T |
 |
| Q |
119 |
agcctttttctatatattcttttttaattatctcatcatgtatcacattgttatttgattcttttgggg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9023456 |
agcctttttctatatattcttttttaattatctcatcatgtatcacattgtgatttgattcttttgggg |
9023388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University