View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11145_high_8 (Length: 287)
Name: NF11145_high_8
Description: NF11145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11145_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 265
Target Start/End: Complemental strand, 48209947 - 48209900
Alignment:
| Q |
218 |
tttatttttgcttctaattgatatccttttattgttatatttaaaaca |
265 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48209947 |
tttatttttgtttctaattgatatccttttattgttatatttaaaaca |
48209900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 48217472 - 48217505
Alignment:
| Q |
19 |
atagttgcaaattataacctagcaaacaaaataa |
52 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
48217472 |
atagttgcaaattgtaacctagcaaacaaaataa |
48217505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University