View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11145_high_8 (Length: 287)

Name: NF11145_high_8
Description: NF11145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11145_high_8
NF11145_high_8
[»] chr4 (2 HSPs)
chr4 (218-265)||(48209900-48209947)
chr4 (19-52)||(48217472-48217505)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 265
Target Start/End: Complemental strand, 48209947 - 48209900
Alignment:
218 tttatttttgcttctaattgatatccttttattgttatatttaaaaca 265  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||    
48209947 tttatttttgtttctaattgatatccttttattgttatatttaaaaca 48209900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 48217472 - 48217505
Alignment:
19 atagttgcaaattataacctagcaaacaaaataa 52  Q
    ||||||||||||| ||||||||||||||||||||    
48217472 atagttgcaaattgtaacctagcaaacaaaataa 48217505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University