View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11145_low_3 (Length: 321)
Name: NF11145_low_3
Description: NF11145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11145_low_3 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 30700 - 30427
Alignment:
| Q |
19 |
tacctccacaggacacctgaccacaaaccaataaatagatatttcagcataaactagtcataactattattagtagaaaaacactaatgactattttaca |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30700 |
tacctccacaagacacctgaccacaaaccaataaatagatatttcagcataa-ctagtcataactattattagtaaaaaaacactaatgactattttaca |
30602 |
T |
 |
| Q |
119 |
gccgaccctgagagaactttgtcgttaaactcttatcac--taagctaacacctttatggcgttatgtaattcaatggaagctaattagagatgataaga |
216 |
Q |
| |
|
|||||||||||||||||| || | | |||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30601 |
atcgaccctgagagaactttatctcttgagg-ttatgacgttaagctaacacctt-atggcattatgtaattcaatggaagctaattagagatgataaga |
30504 |
T |
 |
| Q |
217 |
taagaaaaaattacataattagaaagcgctatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttc |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
30503 |
taagaaaaaagtacataattagaaagcgctatttgtgaaggtgaaatcatttccactatgaaagtgactgttgtttc |
30427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 246 - 313
Target Start/End: Complemental strand, 65704 - 65637
Alignment:
| Q |
246 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65704 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgct |
65637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University