View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11145_low_4 (Length: 309)
Name: NF11145_low_4
Description: NF11145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11145_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 972120 - 971831
Alignment:
| Q |
1 |
ctcactggcttcaagcatgagataaaaattccaaatactttcacaaaaaagctactcagagaaataagagaaatactatcaagagtattcaggatgttga |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972120 |
ctcactggcttcaagcacgagataaaaattccagatactttcacaaaaaagctactcagagaaataagagaaatactatcaagagtattcaggatgttga |
972021 |
T |
|
| Q |
101 |
tgggagatgttggagtgacatcaatcatattaacagtatttttatagattatttcactaatatttttgctacttcaaaccccactaacatgcaggatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972020 |
tgggagatgttggagtgacatcaatcatattaacagtatttttatagattatttcactaatatttttgctacttcaaaccccactaacatgcaggatact |
971921 |
T |
|
| Q |
201 |
attgaagttgttaaaaatataatcaagcctgatatgcatgagtacctctagcaagatttcactgctaccgaggtttttgaggctattaga |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
971920 |
attgaagttgttaaaaatataatcaagcctgatatgcatgagtacctctagcaagatttcactgctactgaggtttttgaggctattaga |
971831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University