View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11146_high_1 (Length: 239)
Name: NF11146_high_1
Description: NF11146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11146_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 19184867 - 19184645
Alignment:
| Q |
1 |
ataaacaacaatatgagtgttttggtggttgaaatgggagaaaagtggggaaaggtacacgaaaatagcatgagttggaggaatatgccattacgtagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19184867 |
ataaacaacaatatgagtgttttggtggttgaaatgggagaaaagtggggaaaggtacacgaaaatagcatgagttggaggaatatgccattatgtagga |
19184768 |
T |
|
| Q |
101 |
ggctgttattttttggcacctatccgatcatatacgacgatgaataggcggtttgataagccatttattgggtggccgtagctcaaaaacaaactagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19184767 |
ggctgttattttttggcacctatccgatcatatacgacgatgaataggcggtttgataagccatttattgggtggccgtagctcaaaaacaaactagtga |
19184668 |
T |
|
| Q |
201 |
ggtggatgaatgtatataacata |
223 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
19184667 |
ggtggatgaatatatataacata |
19184645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University