View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11147_high_3 (Length: 356)
Name: NF11147_high_3
Description: NF11147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11147_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 37823851 - 37823528
Alignment:
| Q |
18 |
aacttggcattcccagctgaagttccaagatttggcttctccatcctgcaatgcaagaagggaattaggagaccatatcccaaccgttggatcaaatcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823851 |
aacttggcattcccagctgaagttccaagatttggcttctccatcctgcaatgcaagaagg-aattaggagaccatatcccaaccgttggatcaaatcaa |
37823753 |
T |
|
| Q |
118 |
atgaaattcaataacaatggtatacatggttatgttatggagcatacatacctaagagaaacaaccatgatgtaggtaatggcagggatgaggtttaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37823752 |
atgaaattcaataacaatggtatacatggttatgttatggagcatacatacctaagagaaacaaccatgatgtaggtaatggcagggatgagatttaaca |
37823653 |
T |
|
| Q |
218 |
tggctacagtatatgtggtagataccaaggccaaagatttaacatataggttttgttgcaaggatcccctgaaagtacaaaattttaatcatttcatact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823652 |
tggctacagtatatgtggtagataccaaggccaaagatttaacatataggttttgttgcaaggatcccctgaaagtacaaaattttaatcatttcatact |
37823553 |
T |
|
| Q |
318 |
taattcttgcttaagcttatgtctt |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37823552 |
taattcttgcttaagcttatgtctt |
37823528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 166 - 291
Target Start/End: Complemental strand, 37820144 - 37820019
Alignment:
| Q |
166 |
tacctaagagaaacaaccatgatgtaggtaatggcagggatgaggtttaacatggctacagtatatgtggtagataccaaggccaaagatttaacatata |
265 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||| |||||||||| || ||||||||| | || ||||| ||||||||||||||||| | |
|
|
| T |
37820144 |
tacctaagagaaacaaccaagaggtaggtaatggctgggatgagatttaacatggttatagtatatgttgctgaaaccaaagccaaagatttaacataga |
37820045 |
T |
|
| Q |
266 |
ggttttgttgcaaggatcccctgaaa |
291 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
37820044 |
ggatttgttgcaaggatcccctgaaa |
37820019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University