View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11148_high_21 (Length: 284)
Name: NF11148_high_21
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11148_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 42159454 - 42159632
Alignment:
| Q |
1 |
tataatgctagctgttccttgggtttgttgctttcattgaactgaacgtgttgctatgtggttttgactacttggaaatttgggttaaaaaggtttaaaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159454 |
tataatgctagttgttccttgggtttgttgctttcattgaactgaacgtgttgctatgtggttttgactacttggaaatttgggttaaaaaggtttaaaa |
42159553 |
T |
 |
| Q |
101 |
tggattttctc-aatcttaaccaccaacaagtacgaagatctagcttctagaaattcattttagaaaagcaattaactt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159554 |
tggattttctcaaatcttaaccaccaacaagtacgaagatctagcttctagaaattcattttagaaaagcaattaactt |
42159632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 177 - 267
Target Start/End: Original strand, 42159661 - 42159753
Alignment:
| Q |
177 |
ttttggtttactcctaagtgatatttttagtgtacatttttgtttgttt--gtttcgaatggatatttttagtatacatgtatggtaaattat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159661 |
ttttggtttactcctaagtgatatttttagtgtacatttttttttttttttgtttcgaatggatatttttagtatacatgtatggtaaattat |
42159753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University