View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11148_high_31 (Length: 237)
Name: NF11148_high_31
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11148_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 35257420 - 35257200
Alignment:
| Q |
1 |
aatcagctggtcatggctctcacgctagaaactacctgctttttcgtaactgcttgagctgannnnnnngtatagccaaagttattactatgctagtgga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35257420 |
aatcagctggtcatggctc--acgctagaaactacctgctttttcgtaattgcttgagctgatttttttgtatagccaaagttattactatgctagtgga |
35257323 |
T |
|
| Q |
101 |
tgacgatcaaatcaaactaccttataacttctactcctcgggctactgctgatgcagatttaattattatcgactgccgagaggagactaatactaactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257322 |
tgacgatcaaatcaaactaccttataacttctactcctcgggctactgctgatgcagatttaattattatcgactgccgagaggagactaatactaactt |
35257223 |
T |
|
| Q |
201 |
atacccacgtttttcattgaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35257222 |
atacccacgtttttcattgaagt |
35257200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University